ORK04908

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04908

Order Kazusa clone(s) from :

Accession No	AB209312
Product ID	ORK04908
Clone name	fh02544
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	BIVM-ERCC5
cDNA sequence	DNA sequence (4928 bp) Predicted protein sequence (1611 aa)
Description	DNA-repair protein complementing XP-G cells (Xeroderma pigmentosum group G-complementing protein) (DNA excision repair protein ERCC-5).

Features of the cloned cDNA sequence

Description

Length: 4928 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	91 bp
Genome contig ID	gi51511729f_102157705
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CGCAAAGACGTAATAAAATTAACTGGTGGCACGGT
Flanking genome sequence (168642 - 168691)	----+--------+--------+--------+--------+----* CTTTGTATTTAGTGTGTGGTTCCTAAAAACAAATGCTAAATCTGACATTT

Features of the protein sequence

Description

Length: 1611 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92549	100.0	DNA-repair prot...	Homo sapiens
XP_509723	99.1	similar to DNA-...	Pan troglodytes
XP_001096257	95.2	XPG-complementi...	Macaca mulatta
XP_001494708	82.6	similar to DNA-...	Equus caballus
CAA49598	99.9	XP-G factor [Ho...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001044	479	502	PR00066	Xeroderma pigmentosum group G protein
	IPR006084	497	516	PR00853	DNA repair protein (XPGC)/yeast Rad
	IPR001044	521	543	PR00066	Xeroderma pigmentosum group G protein
	IPR001044	600	618	PR00066	Xeroderma pigmentosum group G protein
	IPR001044	641	666	PR00066	Xeroderma pigmentosum group G protein
	IPR001044	697	721	PR00066	Xeroderma pigmentosum group G protein
	IPR001044	1069	1087	PR00066	Xeroderma pigmentosum group G protein
	IPR001044	1152	1168	PR00066	Xeroderma pigmentosum group G protein
	IPR006084	1201	1218	PR00853	DNA repair protein (XPGC)/yeast Rad
	IPR006084	1222	1242	PR00853	DNA repair protein (XPGC)/yeast Rad
	IPR006084	1276	1291	PR00853	DNA repair protein (XPGC)/yeast Rad
	IPR001044	1301	1321	PR00066	Xeroderma pigmentosum group G protein
	IPR001044	1404	1424	PR00066	Xeroderma pigmentosum group G protein
HMMPfam	IPR006085	456	523	PF00752	XPG N-terminal
HMMPfam	IPR006086	1202	1290	PF00867	XPG I
HMMSmart	IPR006085	440	523	SM00485	XPG N-terminal
	IPR006086	1202	1271	SM00484	XPG I
	IPR008918	1273	1306	SM00279	Helix-hairpin-helix motif
HMMTigr	IPR001044	447	1454	TIGR00600	Xeroderma pigmentosum group G protein
ScanRegExp	IPR006085	495	509	PS00841	XPG N-terminal
ScanRegExp	IPR006086	1205	1219	PS00842	XPG I

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp