ORK07054

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07054

Order Kazusa clone(s) from :

Accession No	AB209316
Product ID	ORK07054
Clone name	fh03964
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TAF1
cDNA sequence	DNA sequence (5170 bp) Predicted protein sequence (1070 aa)
Description	Transcription initiation factor TFIID subunit 1 (EC 2.7.11.1) (Transcription initiation factor TFIID 250 kDa subunit) (TAF(II)250) (TAFII-250) (TAFII250) (TBP-associated factor 250 kDa) (p250) (Cell cycle gene 1 protein).

Features of the cloned cDNA sequence

Description

Length: 5170 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1955 bp
Genome contig ID	gi89161218f_70424894
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TATGTATTATTTTTGTAATAAAAATTTTAAAAAAT
Flanking genome sequence (177684 - 177733)	----+--------+--------+--------+--------+----* TCCAGCAGTAGTGTGGAGAATGGTTTGGATGGATCTAGTTCAAGTAAGAG

Features of the protein sequence

Description

Length: 1070 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92553	100.0	TBP-associated ...	Homo sapiens
EAX05293	100.0	TAF1 RNA polyme...	Homo sapiens
XP_001493340	99.4	similar to TAF1...	Equus caballus
Q8IZX4	94.6	Transcription i...	Homo sapiens
BAG15901	96.6	TAF1 RNA polyme...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	687	700	PR00503	Bromodomain
	IPR001487	701	717	PR00503	Bromodomain
	IPR001487	717	735	PR00503	Bromodomain
	IPR001487	735	754	PR00503	Bromodomain
HMMPfam	IPR001487	549	636	PF00439	Bromodomain
HMMPfam	IPR001487	671	759	PF00439	Bromodomain
HMMSmart	IPR001487	542	650	SM00297	Bromodomain
HMMSmart	IPR001487	664	773	SM00297	Bromodomain
ProfileScan	IPR001487	561	631	PS50014	Bromodomain
ProfileScan	IPR001487	684	754	PS50014	Bromodomain
ScanRegExp	IPR001487	566	623	PS00633	Bromodomain
ScanRegExp	IPR001487	689	746	PS00633	Bromodomain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp