Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07578
Order Kazusa clone(s) from : Japan || Other countries
Accession No AB209323
Product ID ORK07578
Clone name fh09317
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol AEN
cDNA sequence DNA sequence (5040 bp)
Predicted protein sequence (188 aa)
Description interferon stimulated exonuclease gene 20kDa-like 1
Features of the cloned cDNA sequence

Length: 5040 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : YES
Integrity of 3' end
Length of 3'UTR 1987 bp
Genome contig ID gi51511731f_86870847
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
CATTTGTTCTAGAATAAAACTCAATTGGAAACGTG
Flanking genome sequence
(105671 - 105720)
----+----*----+----*----+----*----+----*----+----*
GGTGAAGTGGCCCTTCCTGTGAATTCTCAAGCTGGGATTGGAGGGTGGCT

Features of the protein sequence

Length: 188 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
BAD92560 1.7e-82 100.0 hypothetical pr...
Homo sapiens
AAL55837 1.5e-60 99.3 unknown [Homo s...
Homo sapiens
BAB14091 1.7e-60 99.3 unnamed protein...
Homo sapiens
NP_073604 2.4e-60 99.3 apoptosis-enhan...
Homo sapiens
Q8WTP8 2.4e-60 99.3 Apoptosis-enhan...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR013520 43 129 PF00929 Exonuclease
HMMSmart IPR006055 10 138 SM00479 Exonuclease
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp