ORK07112

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07112

Order Kazusa clone(s) from :

Accession No	AB209346
Product ID	ORK07112
Clone name	fh13337
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	THRA
cDNA sequence	DNA sequence (4984 bp) Predicted protein sequence (397 aa)
Description	Thyroid hormone receptor alpha (C-erbA-alpha) (c-erbA-1) (EAR-7) (EAR7).

Features of the cloned cDNA sequence

Description

Length: 4984 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3170 bp
Genome contig ID	gi51511734f_35372000
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- ACTATATATTTATGTAATAAATATATGATGAAAAT
Flanking genome sequence (130406 - 130455)	----+--------+--------+--------+--------+----* AACCCCCTTGGGCACCCCCCTTAGACTTGTGTGCTGTTTCCCTATATCCT

Features of the protein sequence

Description

Length: 397 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92583	8.3e-172	100.0	thyroid hormone...	Homo sapiens
CAA38749	2.8e-170	99.7	thyriod hormone...	Homo sapiens
AAX37114	2.8e-170	99.7	unknown [synthe...	synthetic construct
CAA06701	3.3e-170	99.4	thyroid hormone...	Sus scrofa
ACA66242	8.3e-170	99.2	thyroid hormone...	Oryctolagus cun...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001628	40	107	PD000035	Zinc finger
FPrintScan	IPR001728	28	42	PR00546	Thyroid hormone receptor
	IPR001628	40	56	PR00047	Zinc finger
	IPR001628	56	71	PR00047	Zinc finger
	IPR001728	66	77	PR00546	Thyroid hormone receptor
	IPR001628	91	99	PR00047	Zinc finger
	IPR001628	99	107	PR00047	Zinc finger
	IPR001723	103	113	PR00398	Steroid hormone receptor
	IPR001728	105	121	PR00546	Thyroid hormone receptor
	IPR001728	122	140	PR00546	Thyroid hormone receptor
	IPR001728	145	162	PR00546	Thyroid hormone receptor
	IPR001728	168	187	PR00546	Thyroid hormone receptor
	IPR001728	205	226	PR00546	Thyroid hormone receptor
	IPR001723	208	229	PR00398	Steroid hormone receptor
	IPR001723	229	245	PR00398	Steroid hormone receptor
	IPR001728	231	250	PR00546	Thyroid hormone receptor
	IPR001728	296	318	PR00546	Thyroid hormone receptor
	IPR001723	296	311	PR00398	Steroid hormone receptor
	IPR001723	353	370	PR00398	Steroid hormone receptor
HMMPfam	IPR001628	38	115	PF00105	Zinc finger
HMMPfam	IPR000536	210	391	PF00104	Nuclear hormone receptor
HMMSmart	IPR001628	37	110	SM00399	Zinc finger
HMMSmart	IPR000536	207	365	SM00430	Nuclear hormone receptor
ProfileScan	IPR001628	37	114	PS51030	Zinc finger
ScanRegExp	IPR001628	40	66	PS00031	Zinc finger

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp