ORK04291

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04291

Order Kazusa clone(s) from :

Accession No	AB208843
Product ID	ORK04291
Clone name	fh16410
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone fh16410 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCGG ACGCGTGGGT) instead of regular one (GTCGACCCAC GCGTCCG).
Symbol	BTAF1
cDNA sequence	DNA sequence (5437 bp) Predicted protein sequence (699 aa)
Description	TATA-binding protein-associated factor 172 (EC 3.6.1.-) (ATP-dependent helicase BTAF1) (TBP-associated factor 172) (TAF-172) (TAF(II)170) (B- TFIID transcription factor-associated 170 kDa subunit).

Features of the cloned cDNA sequence

Description

Length: 5437 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	1395 bp
Genome contig ID	gi89161187f_93630188
PolyA signal sequence (AATAAA,-30)	+--------+--------+----*----+---- AAGAGAATAAATATAAGATTGAAACTGTAAAATAT
Flanking genome sequence (149879 - 149928)	----+--------+--------+--------+--------+----* ATGCAACTGTGTGTTATTTGTAGGAAATGGTCACTAGAAAGAGCAAAAGA

Features of the protein sequence

Description

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92080	100.0	BTAF1 RNA polym...	Homo sapiens
AAH29930	100.0	BTAF1 protein [...	Homo sapiens
O14981	97.4	TATA-binding pr...	Homo sapiens
XP_543929	96.7	similar to TATA...	Canis lupus fam...
AAH94345	95.2	Btaf1 protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000330	119	435	PF00176	SNF2-related
HMMPfam	IPR001650	516	594	PF00271	DNA/RNA helicase
HMMSmart	IPR014001	112	320	SM00487	DEAD-like helicases
HMMSmart	IPR001650	508	594	SM00490	DNA/RNA helicase
ProfileScan	IPR014021	128	303	PS51192	Helicase
ProfileScan	IPR001650	486	640	PS51194	DNA/RNA helicase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	26	LDVGIVPYIVLLVVPVLGRMSDQ	48	PRIMARY	23