ORK07071

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07071

Order Kazusa clone(s) from :

Accession No	AB209378
Product ID	ORK07071
Clone name	fh18602
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TBX2
cDNA sequence	DNA sequence (5219 bp) Predicted protein sequence (317 aa)
Description	T-box transcription factor TBX2 (T-box protein 2).

Features of the cloned cDNA sequence

Description

Length: 5219 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4264 bp
Genome contig ID	gi51511734f_56732508
PolyA signal sequence (AATAAA,-7)	+--------+--------+----*----+---- ATTTATGAAATAAATGGTAATTTGTGTAAATAAAA
Flanking genome sequence (108761 - 108810)	----+--------+--------+--------+--------+----* GCTTTAAGGTTCCCAGAATATGCAAATTGGTATTAATTTATTCAAAGGTG

Features of the protein sequence

Description

Length: 317 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92615	6.3e-121	100.0	T-box 2 variant...	Homo sapiens
Q13207	3.6e-108	98.6	T-box transcrip...	Homo sapiens
AAA73861	3.6e-108	98.6	TBX2 [Homo sapi...	Homo sapiens
EAW51424	3.7e-108	98.6	T-box 2, isofor...	Homo sapiens
CAH10619	1.2e-107	98.2	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001699	59	83	PR00937	Transcription factor
	IPR002070	104	124	PR00938	Transcription factor
	IPR001699	124	137	PR00937	Transcription factor
	IPR001699	141	150	PR00937	Transcription factor
	IPR001699	160	174	PR00937	Transcription factor
	IPR002070	165	182	PR00938	Transcription factor
	IPR001699	195	208	PR00937	Transcription factor
	IPR001699	216	224	PR00937	Transcription factor
HMMPfam	IPR001699	43	225	PF00907	Transcription factor
HMMSmart	IPR001699	41	229	SM00425	Transcription factor
ProfileScan	IPR001699	46	224	PS50252	Transcription factor
ScanRegExp	IPR001699	51	70	PS01283	Transcription factor
ScanRegExp	IPR001699	125	143	PS01264	Transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp