ORK01398

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01398

Order Kazusa clone(s) from :

Accession No	AB209413
Product ID	ORK01398
Clone name	fh25931
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	DNMT1
cDNA sequence	DNA sequence (5142 bp) Predicted protein sequence (1606 aa)
Description	DNA (cytosine-5)-methyltransferase 1 (EC 2.1.1.37) (Dnmt1) (DNA methyltransferase HsaI) (DNA MTase HsaI) (MCMT) (M.HsaI).

Features of the cloned cDNA sequence

Description

Length: 5142 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	320 bp
Genome contig ID	gi42406306r_10005023
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GTAATATTTCTTCAAATAAATCTCTCCTATAAACC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCCTGGGTGGGTATTCGTGATTTGCACGGGACTTCTGGCTGAGGTCAGA

Features of the protein sequence

Description

Length: 1606 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92650	100.0	DNA (cytosine-5...	Homo sapiens
P26358	99.7	DNA (cytosine-5...	Homo sapiens
EAW84079	99.7	DNA (cytosine-5...	Homo sapiens
XP_001163722	99.6	DNA (cytosine-5...	Pan troglodytes
XP_001163764	99.6	DNA (cytosine-5...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001525	1127	1143	PR00105	C-5 cytosine-specific DNA methylase
	IPR001525	1246	1260	PR00105	C-5 cytosine-specific DNA methylase
	IPR001525	1292	1305	PR00105	C-5 cytosine-specific DNA methylase
HMMPfam	IPR010506	3	93	PF06464	DMAP1-binding
	IPR002857	632	678	PF02008	Zinc finger
	IPR001025	742	867	PF01426	Bromo adjacent region
	IPR001025	953	1087	PF01426	Bromo adjacent region
	IPR001525	1126	1217	PF00145	C-5 cytosine-specific DNA methylase
	IPR001525	1245	1304	PF00145	C-5 cytosine-specific DNA methylase
	IPR001525	1509	1584	PF00145	C-5 cytosine-specific DNA methylase
HMMSmart	IPR001025	742	867	SM00439	Bromo adjacent region
HMMSmart	IPR001025	918	1087	SM00439	Bromo adjacent region
HMMTigr	IPR001525	1128	1582	TIGR00675	C-5 cytosine-specific DNA methylase
ProfileScan	IPR002857	633	679	PS51058	Zinc finger
	IPR001025	742	867	PS51038	Bromo adjacent region
	IPR001025	959	1087	PS51038	Bromo adjacent region
ScanRegExp	IPR001525	1205	1217	PS00094	C-5 cytosine-specific DNA methylase
ScanRegExp	IPR001525	1564	1582	PS00095	C-5 cytosine-specific DNA methylase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp