ORK11812

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11812

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11812
Clone name	fj04323
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CELF2
cDNA sequence	DNA sequence (3861 bp) Predicted protein sequence (543 aa)
Description	CUG-BP- and ETR-3-like factor 2 (CELF-2)(Bruno-like protein 3)(RNA-binding protein BRUNOL-3)(CUG triplet repeat RNA-binding protein 2)(CUG-BP2)(ELAV-type RNA-binding protein 3)(ETR-3)(Neuroblastoma apoptosis-related RNA-binding protein)(hNAPOR)

Features of the cloned cDNA sequence

Description

Length: 3861 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2229 bp
Genome contig ID	gi89161187f_10443519
PolyA signal sequence (None)	+--------+--------+----*----+---- TGATAAGACAAGTTTAGAATTGGTTTACTTAATAC
Flanking genome sequence (969734 - 969783)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAGAATTTCAAAAAAAAAAGTTGTTTGCTTAAAAAAAA

Features of the protein sequence

Description

Length: 543 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW86349	1.6e-169	100.0	CUG triplet rep...	Homo sapiens
AAK72224	1.6e-169	100.0	neuroplastoma a...	Homo sapiens
NP_006552	1.6e-169	100.0	CUG-BP- and ETR...	Homo sapiens
CAA09103	1.6e-169	96.1	ETR-R3b protein...	Rattus norvegicus
CAM18816	2.3e-169	99.7	CUG triplet rep...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	71	140	PF00076	RNA recognition motif
	IPR000504	163	234	PF00076	RNA recognition motif
	IPR000504	460	531	PF00076	RNA recognition motif
HMMSmart	IPR000504	70	148	SM00360	RNA recognition motif
	IPR000504	162	237	SM00360	RNA recognition motif
	IPR000504	459	532	SM00360	RNA recognition motif
ProfileScan	IPR000504	69	152	PS50102	RNA recognition motif
	IPR000504	161	241	PS50102	RNA recognition motif
	IPR000504	458	536	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp