ORK07592

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07592

Order Kazusa clone(s) from :

Accession No	AB208958
Product ID	ORK07592
Clone name	fj04996
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHGA7
cDNA sequence	DNA sequence (4485 bp) Predicted protein sequence (895 aa)
Description	Homo sapiens mRNA for protocadherin gamma subfamily A, 7 isoform 1 precursor variant protein.

Features of the cloned cDNA sequence

Description

Length: 4485 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1795 bp
Genome contig ID	gi51511721f_140642760
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTCTTCGACAAAAAAATAATAAAACGTTTCTTCTG
Flanking genome sequence (229964 - 230013)	----+--------+--------+--------+--------+----* AAAAGCTGAACGTTTCTGTATAAGCGATGGAAGCTCCTGGCATGTGTGCA

Features of the protein sequence

Description

Length: 895 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92195	100.0	protocadherin g...	Homo sapiens
Q9Y5G6	99.7	Protocadherin g...	Homo sapiens
Q5DRB3	99.1	Protocadherin g...	Pan troglodytes
AAT77600	84.9	protocadherin g...	Rattus norvegicus
EDL10129	84.7	mCG133388, isof...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	36	55	PR00205	Cadherin
	IPR002126	205	234	PR00205	Cadherin
	IPR002126	277	289	PR00205	Cadherin
	IPR002126	289	308	PR00205	Cadherin
	IPR002126	413	426	PR00205	Cadherin
	IPR002126	473	499	PR00205	Cadherin
	IPR002126	507	524	PR00205	Cadherin
HMMPfam	IPR013164	1	75	PF08266	Cadherin
	IPR002126	101	196	PF00028	Cadherin
	IPR002126	210	301	PF00028	Cadherin
	IPR002126	315	406	PF00028	Cadherin
	IPR002126	420	516	PF00028	Cadherin
	IPR002126	545	628	PF00028	Cadherin
HMMSmart	IPR002126	8	94	SM00112	Cadherin
	IPR002126	118	203	SM00112	Cadherin
	IPR002126	227	308	SM00112	Cadherin
	IPR002126	332	413	SM00112	Cadherin
	IPR002126	437	523	SM00112	Cadherin
	IPR002126	554	632	SM00112	Cadherin
ProfileScan	IPR002126	38	96	PS50268	Cadherin
	IPR002126	97	205	PS50268	Cadherin
	IPR002126	206	310	PS50268	Cadherin
	IPR002126	311	415	PS50268	Cadherin
	IPR002126	416	525	PS50268	Cadherin
	IPR002126	542	645	PS50268	Cadherin
ScanRegExp	IPR002126	84	94	PS00232	Cadherin
	IPR002126	193	203	PS00232	Cadherin
	IPR002126	298	308	PS00232	Cadherin
	IPR002126	513	523	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	655	YLVVAVATVSCVFLAFVLVLLAL	677	PRIMARY	23