ORK06798

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK06798

Order Kazusa clone(s) from :

Accession No	AB209208
Product ID	ORK06798
Clone name	fj08031
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TRA2B
cDNA sequence	DNA sequence (4485 bp) Predicted protein sequence (278 aa)
Description	Splicing factor, arginine/serine-rich 10 (Transformer-2-beta) (HTRA2- beta) (Transformer 2 protein homolog).

Features of the cloned cDNA sequence

Description

Length: 4485 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	379 bp
Genome contig ID	gi89161205r_187017811
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- AATGGCAAAAAGCAACAATAAACAGTTTGATTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTTCTTTCTAACATATCAATGCTTAGCAGAACTATTCAGATTGTCAG

Features of the protein sequence

Description

Length: 278 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92445	1.4e-100	100.0	splicing factor...	Homo sapiens
EDK97625	1.5e-93	100.0	mCG127344, isof...	Mus musculus
BAE88784	1.5e-93	100.0	unnamed protein...	Macaca fascicularis
P62997	1.5e-93	100.0	Transformer-2 p...	Rattus norvegicus
EAW78207	1.5e-93	100.0	splicing factor...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	108	179	PF00076	RNA recognition motif
HMMSmart	IPR000504	107	180	SM00360	RNA recognition motif
ProfileScan	IPR000504	106	184	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp