ORK07115

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07115

Order Kazusa clone(s) from :

Accession No	AB209211
Product ID	ORK07115
Clone name	fj08835
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	TIA1
cDNA sequence	DNA sequence (4788 bp) Predicted protein sequence (252 aa)
Description	Nucleolysin TIA-1 isoform p40 (RNA-binding protein TIA-1) (p40-TIA-1) [Contains: Nucleolysin TIA-1 isoform p15 (p15-TIA-1)].

Features of the cloned cDNA sequence

Description

Length: 4788 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	3915 bp
Genome contig ID	gi89161199r_70190087
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TTTAAGAGCCTTAATAAAATGTGTGAGTGTGTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTGAATAGGTTTTTCTACCTTCATTTGAAGACCATAATTCATATTCAT

Features of the protein sequence

Description

Length: 252 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92448	3.6e-107	100.0	TIA1 protein va...	Homo sapiens
AAH15944	2.3e-90	100.0	TIA1 protein [H...	Homo sapiens
XP_001098394	4.9e-90	99.5	similar to Nucl...	Macaca mulatta
XP_866473	1.7e-89	99.0	similar to Nucl...	Canis lupus fam...
BAE73002	9.3e-80	100.0	hypothetical pr...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	47	116	PF00076	RNA recognition motif
HMMPfam	IPR000504	146	217	PF00076	RNA recognition motif
HMMSmart	IPR003954	46	117	SM00361	RNA recognition
	IPR000504	46	117	SM00360	RNA recognition motif
	IPR003954	145	218	SM00361	RNA recognition
	IPR000504	145	218	SM00360	RNA recognition motif
ProfileScan	IPR000504	45	121	PS50102	RNA recognition motif
ProfileScan	IPR000504	144	222	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp