ORK11814

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11814

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11814
Clone name	fj12172
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	FOXG1
cDNA sequence	DNA sequence (3196 bp) Predicted protein sequence (546 aa)
Description	Forkhead box protein G1 (Forkhead box protein G1A)(Forkhead box protein G1B)(Forkhead box protein G1C)(Forkhead-related protein FKHL1)(HFK1)(Forkhead-related protein FKHL2)(HFK2)(Forkhead-related protein FKHL3)(HFK3)(Transcription factor BF-1)(Brain factor 1)(BF1)(Transcription factor BF-2)(Brain factor 2)(hBF-2)(BF2)

Features of the cloned cDNA sequence

Description

Length: 3196 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	914 bp
Genome contig ID	gi51511730f_28204359
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- AACACACAGAAATAAAAAATAGGCTAAATTCATAT
Flanking genome sequence (104268 - 104317)	----+--------+--------+--------+--------+----* ATATCTTGATACTTTTGTCTCTTTTATTAAGTAGAGCTAATTTTTTAAAG

Features of the protein sequence

Description

Length: 546 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P55316	6.5e-126	100.0	Forkhead box pr...	Homo sapiens
Q1A1A5	1.3e-125	99.7	Forkhead box pr...	Chlorocebus pyg...
Q1A1A6	1.6e-125	99.5	Forkhead box pr...	Cebus capucinus
AAH50072	6e-125	99.3	Forkhead box G1...	Homo sapiens
XP_001249413	4.4e-123	98.5	similar to brai...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001766	242	325	PD000425	Fork head transcription factor
FPrintScan	IPR001766	238	251	PR00053	Fork head transcription factor
	IPR001766	259	276	PR00053	Fork head transcription factor
	IPR001766	282	299	PR00053	Fork head transcription factor
HMMPfam	IPR001766	238	333	PF00250	Fork head transcription factor
HMMSmart	IPR001766	236	326	SM00339	Fork head transcription factor
ProfileScan	IPR001766	238	332	PS50039	Fork head transcription factor
ScanRegExp	IPR001766	238	251	PS00657	Fork head transcription factor
ScanRegExp	IPR001766	282	288	PS00658	Fork head transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp