ORK07605

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07605

Order Kazusa clone(s) from :

Accession No	AB208927
Product ID	ORK07605
Clone name	fj19046
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHGA3
cDNA sequence	DNA sequence (4763 bp) Predicted protein sequence (961 aa)
Description	Homo sapiens mRNA for protocadherin gamma subfamily A, 3 isoform 1 precursor variant protein.

Features of the cloned cDNA sequence

Description

Length: 4763 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1798 bp
Genome contig ID	gi51511721f_140603619
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TTCTTCGACAAAAAAATAATAAAACGTTTCTTCTG
Flanking genome sequence (269105 - 269154)	----+--------+--------+--------+--------+----* AAAAGCTGAACGTTTCTGTATAAGCGATGGAAGCTCCTGGCATGTGTGCA

Features of the protein sequence

Description

Length: 961 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92164	100.0	protocadherin g...	Homo sapiens
EAW61936	99.8	hCG1982215, iso...	Homo sapiens
Q9Y5H0	99.5	Protocadherin g...	Homo sapiens
Q5DRB7	99.1	Protocadherin g...	Pan troglodytes
AAT77596	86.1	protocadherin g...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	102	121	PR00205	Cadherin
	IPR002126	271	300	PR00205	Cadherin
	IPR002126	343	355	PR00205	Cadherin
	IPR002126	355	374	PR00205	Cadherin
	IPR002126	479	492	PR00205	Cadherin
	IPR002126	539	565	PR00205	Cadherin
	IPR002126	573	590	PR00205	Cadherin
HMMPfam	IPR013164	58	141	PF08266	Cadherin
	IPR002126	167	262	PF00028	Cadherin
	IPR002126	276	367	PF00028	Cadherin
	IPR002126	381	472	PF00028	Cadherin
	IPR002126	486	582	PF00028	Cadherin
	IPR002126	611	694	PF00028	Cadherin
HMMSmart	IPR002126	48	160	SM00112	Cadherin
	IPR002126	184	269	SM00112	Cadherin
	IPR002126	293	374	SM00112	Cadherin
	IPR002126	398	479	SM00112	Cadherin
	IPR002126	503	589	SM00112	Cadherin
	IPR002126	620	698	SM00112	Cadherin
ProfileScan	IPR002126	57	162	PS50268	Cadherin
	IPR002126	163	271	PS50268	Cadherin
	IPR002126	272	376	PS50268	Cadherin
	IPR002126	377	481	PS50268	Cadherin
	IPR002126	482	591	PS50268	Cadherin
	IPR002126	608	711	PS50268	Cadherin
ScanRegExp	IPR002126	150	160	PS00232	Cadherin
	IPR002126	259	269	PS00232	Cadherin
	IPR002126	364	374	PS00232	Cadherin
	IPR002126	469	479	PS00232	Cadherin
	IPR002126	579	589	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	721	YLVVAVAAVSCVFLAFVIVLLAL	743	PRIMARY	23