ORK07609

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07609

Order Kazusa clone(s) from :

Accession No	AB208959
Product ID	ORK07609
Clone name	fk01625
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PCDHB9
cDNA sequence	DNA sequence (3758 bp) Predicted protein sequence (716 aa)
Description	Homo sapiens mRNA for protocadherin beta 9 precursor variant protein.

Features of the cloned cDNA sequence

Description

Length: 3758 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1606 bp
Genome contig ID	gi51511721f_140447319
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TAAAAAGAACTTTGAATAAAATTCTATGAAAAAAG
Flanking genome sequence (103758 - 103807)	----+--------+--------+--------+--------+----* ACACTAGAATGCTGTTCTTAATTTTAATAGTGTTAAGATAGGTGTTAGTG

Features of the protein sequence

Description

Length: 716 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD92196	100.0	protocadherin b...	Homo sapiens
AAI00673	99.8	Protocadherin b...	Homo sapiens
Q9Y5E1	99.7	Protocadherin b...	Homo sapiens
AAI03495	99.5	PCDHB9 protein ...	Homo sapiens
AAF81913	99.4	protocadherin b...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002126	161	190	PR00205	Cadherin
	IPR002126	233	245	PR00205	Cadherin
	IPR002126	245	264	PR00205	Cadherin
	IPR002126	368	381	PR00205	Cadherin
	IPR002126	428	454	PR00205	Cadherin
	IPR002126	462	479	PR00205	Cadherin
HMMPfam	IPR013164	1	31	PF08266	Cadherin
	IPR002126	57	152	PF00028	Cadherin
	IPR002126	166	257	PF00028	Cadherin
	IPR002126	271	361	PF00028	Cadherin
	IPR002126	375	471	PF00028	Cadherin
	IPR002126	499	582	PF00028	Cadherin
HMMSmart	IPR002126	74	159	SM00112	Cadherin
	IPR002126	183	264	SM00112	Cadherin
	IPR002126	287	368	SM00112	Cadherin
	IPR002126	392	478	SM00112	Cadherin
	IPR002126	508	589	SM00112	Cadherin
ProfileScan	IPR002126	1	52	PS50268	Cadherin
	IPR002126	53	161	PS50268	Cadherin
	IPR002126	162	266	PS50268	Cadherin
	IPR002126	267	370	PS50268	Cadherin
	IPR002126	371	480	PS50268	Cadherin
	IPR002126	495	590	PS50268	Cadherin
ScanRegExp	IPR002126	40	50	PS00232	Cadherin
	IPR002126	149	159	PS00232	Cadherin
	IPR002126	254	264	PS00232	Cadherin
	IPR002126	358	368	PS00232	Cadherin
	IPR002126	468	478	PS00232	Cadherin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	608	YLVVALASVSSLFLLSVLLFVAV	630	PRIMARY	23