ORK04629

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04629

Order Kazusa clone(s) from :

Accession No	AB209533
Product ID	ORK04629
Clone name	fk10959
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CREM
cDNA sequence	DNA sequence (2929 bp) Predicted protein sequence (163 aa)
Description	cAMP-responsive element modulator (Inducible cAMP early repressor) (ICER).

Features of the cloned cDNA sequence

Description

Length: 2929 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	473 bp
Genome contig ID	gi89161187f_35413000
PolyA signal sequence (AATATA,-14)	+--------+--------+----*----+---- TAGTTGCTTTTGAAGGAATACAATATATAGCTGGC
Flanking genome sequence (127807 - 127856)	----+--------+--------+--------+--------+----* AAGAATGGTGGCTTCTTTTCTTTGTATCATTCATCTTCTTCTTTAATCAC

Features of the protein sequence

Description

Length: 163 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92770	1e-54	100.0	cAMP responsive...	Homo sapiens
XP_001093063	1.6e-54	99.3	cAMP responsive...	Macaca mulatta
XP_001092950	1.7e-54	99.3	cAMP responsive...	Macaca mulatta
XP_001093168	1.8e-54	99.3	cAMP responsive...	Macaca mulatta
XP_001092367	1.9e-54	99.3	cAMP responsive...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001630	64	75	PR00041	cAMP response element binding (CREB) protein
	IPR001630	102	118	PR00041	cAMP response element binding (CREB) protein
	IPR001630	120	140	PR00041	cAMP response element binding (CREB) protein
	IPR001630	140	157	PR00041	cAMP response element binding (CREB) protein
HMMPfam	IPR011616	103	163	PF00170	bZIP transcription factor
HMMSmart	IPR004827	103	161	SM00338	Basic-leucine zipper (bZIP) transcription factor
ProfileScan	IPR004827	105	156	PS50217	Basic-leucine zipper (bZIP) transcription factor
ScanRegExp	IPR004827	111	125	PS00036	Basic-leucine zipper (bZIP) transcription factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp