ORK04180

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04180

Order Kazusa clone(s) from :

Accession No	AB209059
Product ID	ORK04180
Clone name	hc00438
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARPC1A
cDNA sequence	DNA sequence (1539 bp) Predicted protein sequence (401 aa)
Description	Actin-related protein 2/3 complex subunit 1A (SOP2-like protein).

Features of the cloned cDNA sequence

Description

Length: 1539 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	332 bp
Genome contig ID	gi89161213f_98661499
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GTCCACTAGAAAATTAAATAAAAGAACTGAATGTG
Flanking genome sequence (140323 - 140372)	----+--------+--------+--------+--------+----* GTTTTGGTTTTGTTTCCTTGTAGTATTTCAATTTTTAGTAGAAAAATATG

Features of the protein sequence

Description

Length: 401 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92296	3.4e-176	100.0	actin related p...	Homo sapiens
XP_536873	2.1e-173	99.0	similar to acti...	Canis lupus fam...
Q92747	1.1e-161	99.7	Actin-related p...	Homo sapiens
Q1JP79	2.5e-161	99.4	Actin-related p...	Bos taurus
BAE87145	3.4e-161	99.4	unnamed protein...	Macaca fascicularis

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001680	73	111	PF00400	WD40 repeat
HMMPfam	IPR001680	163	201	PF00400	WD40 repeat
HMMSmart	IPR001680	72	111	SM00320	WD40 repeat
	IPR001680	116	155	SM00320	WD40 repeat
	IPR001680	165	201	SM00320	WD40 repeat
	IPR001680	222	263	SM00320	WD40 repeat
	IPR001680	266	304	SM00320	WD40 repeat
	IPR001680	343	387	SM00320	WD40 repeat
ProfileScan	IPR001680	79	111	PS50082	WD40 repeat
ProfileScan	IPR001680	79	120	PS50294	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp