ORK04685

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04685

Order Kazusa clone(s) from :

Accession No	AB209037
Product ID	ORK04685
Clone name	hh01315
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CX3CL1
cDNA sequence	DNA sequence (5794 bp) Predicted protein sequence (381 aa)
Description	Fractalkine precursor (CX3CL1) (Neurotactin) (CX3C membrane-anchored chemokine) (Small inducible cytokine D1).

Features of the cloned cDNA sequence

Description

Length: 5794 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2010 bp
Genome contig ID	gi51511732f_55868385
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTGTATTTTACTAATAAAATTTAAAAGTCTTGTG
Flanking genome sequence (108072 - 108121)	----+--------+--------+--------+--------+----* AATCAATATGGGTGATTTCTCTGGGGACAAGTGCAGCAATCAGGGCTTCG

Features of the protein sequence

Description

Length: 381 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92274	8.5e-120	100.0	chemokine (C-X3...	Homo sapiens
P78423	8.2e-118	99.2	Fractalkine; C-...	Homo sapiens
AAX36853	8.2e-118	99.2	chemokine (C-X3...	synthetic construct
AAX36854	8.2e-118	99.2	chemokine (C-X3...	synthetic construct
BAD96412	1.5e-117	98.9	chemokine (C-X3...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR008097	5	16	PR01721	Fractalkine/neurotactin
	IPR008097	33	47	PR01721	Fractalkine/neurotactin
	IPR008097	49	66	PR01721	Fractalkine/neurotactin
	IPR008097	68	85	PR01721	Fractalkine/neurotactin
	IPR008097	192	203	PR01721	Fractalkine/neurotactin
	IPR008097	255	274	PR01721	Fractalkine/neurotactin
	IPR008097	276	298	PR01721	Fractalkine/neurotactin
	IPR008097	299	317	PR01721	Fractalkine/neurotactin
	IPR008097	319	335	PR01721	Fractalkine/neurotactin
	IPR008097	337	355	PR01721	Fractalkine/neurotactin
	IPR008097	356	380	PR01721	Fractalkine/neurotactin
HMMPfam	IPR001811	10	73	PF00048	Small chemokine
HMMSmart	IPR001811	13	73	SM00199	Small chemokine

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	326	AVGLLAFLGLLFCLGVAMFTYQS	348	PRIMARY	23