ORK07037

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07037

Order Kazusa clone(s) from :

Accession No	AB209098
Product ID	ORK07037
Clone name	hh03137
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	SYNCRIP
cDNA sequence	DNA sequence (6167 bp) Predicted protein sequence (534 aa)
Description	Heterogeneous nuclear ribonucleoprotein Q (hnRNP Q) (hnRNP-Q) (Synaptotagmin-binding, cytoplasmic RNA-interacting protein) (Glycine- and tyrosine-rich RNA-binding protein) (GRY-RBP) (NS1-associated protein 1).

Features of the cloned cDNA sequence

Description

Length: 6167 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	4560 bp
Genome contig ID	gi89161210r_86274759
PolyA signal sequence (None)	+--------+--------+----*----+---- AATAAAGACCTATTTTTGTAGCATGTCTTAGGATC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCCAGGAGTCCAAGAATTATTGTGGGTGTCCTCCAATTCATCACTCTTCA

Features of the protein sequence

Description

Length: 534 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92335	1.2e-189	100.0	synaptotagmin b...	Homo sapiens
CAI20446	7e-182	100.0	synaptotagmin b...	Homo sapiens
BAC28852	1.2e-181	99.8	unnamed protein...	Mus musculus
AAD38198	1.2e-181	99.8	NSAP1 protein [...	Homo sapiens
AAH58807	2.4e-181	99.6	Syncrip protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000504	136	202	PF00076	RNA recognition motif
	IPR000504	217	278	PF00076	RNA recognition motif
	IPR000504	312	375	PF00076	RNA recognition motif
HMMSmart	IPR000504	135	209	SM00360	RNA recognition motif
	IPR000504	216	293	SM00360	RNA recognition motif
	IPR000504	311	376	SM00360	RNA recognition motif
HMMTigr	IPR006535	75	534	TIGR01648	HnRNP R and Q splicing factor
ProfileScan	IPR000504	134	213	PS50102	RNA recognition motif
	IPR000504	215	297	PS50102	RNA recognition motif
	IPR000504	310	380	PS50102	RNA recognition motif

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp