ORK04504

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK04504

Order Kazusa clone(s) from :

Accession No	AB208903
Product ID	ORK04504
Clone name	hk00816
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	CDC40
cDNA sequence	DNA sequence (3844 bp) Predicted protein sequence (501 aa)
Description	Pre-mRNA-processing factor 17 (PRP17 homolog) (hPRP17) (Cell division cycle 40 homolog) (EH-binding protein 3) (Ehb3).

Features of the cloned cDNA sequence

Description

Length: 3844 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	2337 bp
Genome contig ID	gi89161210f_110508343
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAGCATTTTTTGTAGAAAGTGCTATCAAAATGTT
Flanking genome sequence (151791 - 151840)	----+--------+--------+--------+--------+----* CATCTTGTTCATCTTTAGTCTCCTTTTGAGTCTTAAGTGTATTGAGACAC

Features of the protein sequence

Description

Length: 501 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92140	2.1e-196	100.0	pre-mRNA splici...	Homo sapiens
CAI13321	8.8e-196	99.8	cell division c...	Homo sapiens
O60508	9.3e-196	99.8	Pre-mRNA-proces...	Homo sapiens
BAD96441	1.9e-195	99.6	pre-mRNA splici...	Homo sapiens
XP_001088397	2.8e-195	99.4	cell division c...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001680	285	317	PD000018	WD40 repeat
BlastProDom	IPR001680	326	360	PD000018	WD40 repeat
FPrintScan	IPR001680	303	317	PR00320	WD40 repeat
	IPR001680	346	360	PR00320	WD40 repeat
	IPR001680	432	446	PR00320	WD40 repeat
HMMPfam	IPR001680	277	316	PF00400	WD40 repeat
	IPR001680	321	359	PF00400	WD40 repeat
	IPR001680	363	403	PF00400	WD40 repeat
	IPR001680	407	445	PF00400	WD40 repeat
HMMSmart	IPR001680	276	316	SM00320	WD40 repeat
	IPR001680	320	359	SM00320	WD40 repeat
	IPR001680	362	403	SM00320	WD40 repeat
	IPR001680	406	445	SM00320	WD40 repeat
	IPR001680	451	488	SM00320	WD40 repeat
ProfileScan	IPR001680	283	317	PS50082	WD40 repeat
	IPR001680	283	497	PS50294	WD40 repeat
	IPR001680	327	368	PS50082	WD40 repeat
	IPR001680	413	445	PS50082	WD40 repeat
ScanRegExp	IPR001680	303	317	PS00678	WD40 repeat

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp