ORK07666

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK07666

Order Kazusa clone(s) from :

Accession No	AB208830
Product ID	ORK07666
Clone name	hk01625
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	ARID3B
cDNA sequence	DNA sequence (4316 bp) Predicted protein sequence (476 aa)
Description	AT rich interactive domain 3B

Features of the cloned cDNA sequence

Description

Length: 4316 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : YES

Integrity of 3' end

Length of 3'UTR	2858 bp
Genome contig ID	gi51511731f_72520652
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTTTATATTTCAATAAACCTCTACCTCTTCACAC
Flanking genome sequence (156873 - 156922)	----+--------+--------+--------+--------+----* AAGCAGGTCTCTCTCAGTTGCTTTGAGTGGCCTTTCCACTGGACAGTACT

Features of the protein sequence

Description

Length: 476 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD92067	8.4e-163	100.0	AT rich interac...	Homo sapiens
BAG60872	1.1e-129	100.0	unnamed protein...	Homo sapiens
AAD09133	1.3e-129	100.0	bright and dead...	Homo sapiens
Q8IVW6	1.3e-129	100.0	AT-rich interac...	Homo sapiens
BAG63430	2.5e-129	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001606	253	363	PF01388	AT-rich interaction region
HMMSmart	IPR001606	257	349	SM00501	AT-rich interaction region
ProfileScan	IPR001606	256	348	PS51011	AT-rich interaction region

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp