ORK11857

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK11857

Order Kazusa clone(s) from :

Accession No
Product ID	ORK11857
Clone name	pf02338
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	C2CD3
cDNA sequence	DNA sequence (7791 bp) Predicted protein sequence (2362 aa)
Description	C2 domain-containing protein

Features of the cloned cDNA sequence

Description

Length: 7791 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	665 bp
Genome contig ID	gi51511727r_73301413
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGCCTGTGTTTGAATAAAATCATATTGGTGTTTGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATCTGTGCACAAGTGTTTCGCTGGAGTGGGGATGCTAGGAATTCGTGTG

Features of the protein sequence

Description

Length: 2362 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q4AC94	99.9	C2 domain-conta...	Homo sapiens
XP_001174891	99.1	hypothetical pr...	Pan troglodytes
XP_001115612	95.8	hypothetical pr...	Macaca mulatta
NP_056346	100.0	C2 domain-conta...	Homo sapiens
BAE17137	99.6	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	1646	1737	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	548	686	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	815	924	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	1014	1154	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	1207	1346	SM00239	C2 calcium-dependent membrane targeting
	IPR000008	1645	1752	SM00239	C2 calcium-dependent membrane targeting

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp