ORK01517

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01517

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01517
Clone name	bm04669
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	ARF1
cDNA sequence	DNA sequence (1838 bp) Predicted protein sequence (213 aa)
HaloTag ORF Clone	FHC01517
Flexi ORF Clone	FXC01517
Description	ADP-ribosylation factor 1.

Features of the cloned cDNA sequence

Description

Length: 1838 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1196 bp
Genome contig ID	gi89161185f_226237031
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AATTATAGCTATTAGAATAAAATCTCTTAACTATT
Flanking genome sequence (116504 - 116553)	----+--------+--------+--------+--------+----* TCACCGGCTCTCCAGTGCTTCCACACAGGCATGCTGCCCCCAGGAGATGG

Features of the protein sequence

Description

Length: 213 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
P84079	3.3e-72	100.0	ADP-ribosylatio...	Rattus norvegicus
P51643	5.3e-72	99.4	ADP-ribosylatio...	Xenopus laevis
BAE31170	7.2e-72	99.4	unnamed protein...	Mus musculus
BAE28685	8.4e-72	99.4	unnamed protein...	Mus musculus
BAE40054	8.4e-72	99.4	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	50	71	PR00449	Ras GTPase
	IPR006689	51	74	PR00328	ARF/SAR superfamily
	IPR006689	79	103	PR00328	ARF/SAR superfamily
	IPR001806	86	108	PR00449	Ras GTPase
	IPR006689	106	131	PR00328	ARF/SAR superfamily
	IPR001806	149	162	PR00449	Ras GTPase
	IPR006689	151	172	PR00328	ARF/SAR superfamily
HMMPfam	IPR006689	36	209	PF00025	ARF/SAR superfamily
HMMSmart	IPR006687	31	209	SM00178	GTP-binding protein SAR1
	IPR006688	33	213	SM00177	ADP-ribosylation factor
	IPR003579	50	212	SM00175	Ras small GTPase
HMMTigr	IPR005225	47	207	TIGR00231	Small GTP-binding protein domain
ScanRegExp	IPR006688	183	205	PS01019	ADP-ribosylation factor

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp