Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01558
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01558
Clone name ek00030
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol VCP
cDNA sequence DNA sequence (3239 bp)
Predicted protein sequence (822 aa)
Flexi ORF Clone FXC01558
Description valosin-containing protein
Features of the cloned cDNA sequence

Length: 3239 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 553 bp
Genome contig ID gi89161216r_34946561
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
GTTGTAAAAGGACAATAAACGTTGGGTCAAAATGG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCCTGAGTCCTGGGCCCTGTGCCTGCTTCTTTTCCTGGGAACAGCCTTG

Features of the protein sequence

Length: 822 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
EDL02501 0 99.8 valosin contain...
Mus musculus
P55072 0 100.0 Transitional en...
Homo sapiens
CAA78412 0 99.8 murine valosin-...
Mus musculus
1R7R 0 99.8 Transitional en...
Mus musculus
P46462 0 99.8 Transitional en...
Rattus norvegicus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR003338 38 124 PF02359 AAA ATPase VAT
IPR003959 256 440 PF00004 AAA ATPase
IPR003959 529 716 PF00004 AAA ATPase
HMMSmart IPR003593 253 389 SM00382 AAA+ ATPase
IPR003593 526 665 SM00382 AAA+ ATPase
HMMTigr IPR005938 39 782 TIGR01243 AAA ATPase
ScanRegExp IPR003960 357 375 PS00674 AAA ATPase
IPR003960 633 651 PS00674 AAA ATPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp