Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK01779
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK01779
Clone name sj06327
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
Symbol CTDSP2
cDNA sequence DNA sequence (4731 bp)
Predicted protein sequence (271 aa)
Flexi ORF Clone FXC01779
Description CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase 2
Features of the cloned cDNA sequence

Length: 4731 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 3657 bp
Genome contig ID gi89161190r_56399995
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
TGTATTACTTACAATTAATTAATAAAAGTGGGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAACCTTTCCAGGAATGTGAGCTGCCACCAACCTTCATTGGCCCTTA

Features of the protein sequence

Length: 271 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
O14595 8e-124 100.0 Carboxy-termina...
Homo sapiens
AAD09331 2.2e-123 99.6 unknown protein...
Homo sapiens
AAI05532 8.5e-123 98.5 CTD (carboxy-te...
Bos taurus
XP_538256 1.2e-122 98.1 similar to Carb...
Canis lupus fam...
EAW97082 3.3e-122 97.8 CTD (carboxy-te...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004274 93 267 PF03031 NLI interacting factor
HMMSmart IPR004274 100 243 SM00577 NLI interacting factor
HMMTigr IPR011948 101 265 TIGR02251 Dullard-like phosphatase domain
ProfileScan IPR004274 97 255 PS50969 NLI interacting factor
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp