ORK01921

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK01921

Order Kazusa clone(s) from :

Accession No
Product ID	ORK01921
Clone name	hk04051
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	RAB21
cDNA sequence	DNA sequence (4185 bp) Predicted protein sequence (247 aa)
HaloTag ORF Clone	FHC01921
Flexi ORF Clone	FXC01921
Description	Ras-related protein Rab-21.

Features of the cloned cDNA sequence

Description

Length: 4185 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3265 bp
Genome contig ID	gi89161190f_70334935
PolyA signal sequence (AATATA,-20)	+--------+--------+----*----+---- TATGTTATTGTATGAAATATAAGTGTTCAGATTTG
Flanking genome sequence (134052 - 134101)	----+--------+--------+--------+--------+----* TTTTGTCTGGGGTGTTGCCTAAGAATACCCTAAAGCTATGGCTGTTACTG

Features of the protein sequence

Description

Length: 247 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9UL25	2.7e-85	100.0	Ras-related pro...	Homo sapiens
XP_522469	4.8e-84	99.5	similar to GTP-...	Pan troglodytes
P55745	2.7e-83	98.2	Ras-related pro...	Canis lupus fam...
XP_001117520	6.3e-83	98.6	similar to Ras-...	Macaca mulatta
Q17R06	1.1e-81	96.4	Ras-related pro...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	42	63	PR00449	Ras GTPase
	IPR001806	65	81	PR00449	Ras GTPase
	IPR001806	83	105	PR00449	Ras GTPase
	IPR001806	145	158	PR00449	Ras GTPase
	IPR001806	180	202	PR00449	Ras GTPase
HMMPfam	IPR013753	43	204	PF00071	Ras
HMMSmart	IPR003577	39	205	SM00173	Ras small GTPase
	IPR003579	42	205	SM00175	Ras small GTPase
	IPR003578	44	205	SM00174	Ras small GTPase
	IPR002041	47	237	SM00176	Ran GTPase
HMMTigr	IPR005225	39	200	TIGR00231	Small GTP-binding protein domain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp