ORK03294

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK03294

Order Kazusa clone(s) from :

Accession No
Product ID	ORK03294
Clone name	fh08980
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACGCGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
Symbol	PIK3C3
cDNA sequence	DNA sequence (6145 bp) Predicted protein sequence (899 aa)
HaloTag ORF Clone	FHC03294
Flexi ORF Clone	FXC03294
Description	Phosphatidylinositol 3-kinase catalytic subunit type 3 (EC 2.7.1.137) (PtdIns-3-kinase type 3) (PI3-kinase type 3) (PI3K type 3) (Phosphoinositide-3-kinase class 3) (Phosphatidylinositol 3-kinase p100 subunit).

Features of the cloned cDNA sequence

Description

Length: 6145 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: YES

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	3445 bp
Genome contig ID	gi51511735f_37689219
PolyA signal sequence (AATATA,-30)	+--------+--------+----*----+---- ATCTGAATATAGTATAGAGTAGCTAAAAACAAACC
Flanking genome sequence (229330 - 229379)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGGAAAAACAGAATAAGCCTCAGAAGATAG

Features of the protein sequence

Description

Length: 899 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8NEB9	100.0	Phosphatidylino...	Homo sapiens
AAX43278	100.0	phosphoinositid...	synthetic construct
XP_001082892	99.5	similar to phos...	Macaca mulatta
XP_001497818	99.0	phosphoinositid...	Equus caballus
XP_547599	98.6	similar to phos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002420	65	210	PF00792	Phosphoinositide 3-kinase
	IPR001263	296	542	PF00613	Phosphoinositide 3-kinase accessory region PIK
	IPR000403	642	845	PF00454	Phosphatidylinositol 3- and 4-kinase
HMMSmart	IPR002420	33	142	SM00142	Phosphoinositide 3-kinase
	IPR001263	295	542	SM00145	Phosphoinositide 3-kinase accessory region PIK
	IPR000403	644	896	SM00146	Phosphatidylinositol 3- and 4-kinase
ProfileScan	IPR000403	643	897	PS50290	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	647	661	PS00915	Phosphatidylinositol 3- and 4-kinase
ScanRegExp	IPR000403	740	760	PS00916	Phosphatidylinositol 3- and 4-kinase

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp