ORK05470

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK05470

Order Kazusa clone(s) from :

Accession No	AB209813
Product ID	ORK05470
Clone name	bm04335
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	KAT5
cDNA sequence	DNA sequence (1876 bp) Predicted protein sequence (448 aa)
Description	Histone acetyltransferase HTATIP (EC 2.3.1.48) (EC 2.3.1.-) (60 kDa Tat interactive protein) (Tip60) (HIV-1 Tat interactive protein) (cPLA(2)-interacting protein).

Features of the cloned cDNA sequence

Description

Length: 1876 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	422 bp
Genome contig ID	gi51511727f_65136667
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTATTGCCCCCGGCAATAAATTGTTTCTATATGCC
Flanking genome sequence (106985 - 107034)	----+--------+--------+--------+--------+----* AGAGCCATGCAAAGTTCTTGGTGGGGAGGGGGAAAGGGCCCATGCTGGCT

Features of the protein sequence

Description

Length: 448 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAD93050	1.2e-180	100.0	HIV-1 Tat inter...	Homo sapiens
EDL33156	6e-177	98.6	HIV-1 tat inter...	Mus musculus
AAH00166	3.3e-175	100.0	KAT5 protein [H...	Homo sapiens
Q5RBG4	3.3e-175	100.0	Histone acetylt...	Pongo abelii
AAX43690	3.3e-175	100.0	HIV-1 Tat inter...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002717	220	412	PF01853	MOZ/SAS-like protein
HMMSmart	IPR000953	12	63	SM00298	Chromo

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	5	KAPVYAILIALAEILSVKDISG	26	PRIMARY	22