Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK07782
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK07782
Clone name bm01888
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol ATP5B
cDNA sequence DNA sequence (1739 bp)
Predicted protein sequence (530 aa)
Flexi ORF Clone FXC07782
Description ATP synthase, H+ transporting, mitochondrial F1 complex, beta polypeptide
Features of the cloned cDNA sequence

Length: 1739 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: YES
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 146 bp
Genome contig ID gi89161190r_55218228
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TATTTAAGGTTTCCAATAAAATGTACACCCCTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTGTCTGATTCTCTTGGTTCTGACAACATAGTCAACACTGAAGGGTT

Features of the protein sequence

Length: 530 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
P06576 2.3e-191 100.0 ATP synthase su...
Homo sapiens
XP_509149 2.1e-189 99.2 ATP synthase, H...
Pan troglodytes
XP_001091520 1.9e-187 98.2 ATP synthase, H...
Macaca mulatta
AAA51808 1.1e-186 97.9 ATP synthase be...
Homo sapiens
CAA27246 1.7e-186 98.4 unnamed protein...
Homo sapiens
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
HMMPfam IPR004100 64 130 PF02874 ATPase
IPR000194 186 406 PF00006 ATPase
IPR000793 419 526 PF00306 ATPase
HMMSmart IPR003593 199 383 SM00382 AAA+ ATPase
HMMTigr IPR005722 60 524 TIGR01039 ATPase
ScanRegExp IPR000194 397 406 PS00152 ATPase
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp