ORK10534

Kazusa Clone (Original Type)

Gene/Protein Characteristic Table for ORK10534

Order Kazusa clone(s) from :

Accession No
Product ID	ORK10534
Clone name	bm05954
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector (Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGCTGAAGCTTTCACAAGTTTGTAC AAAAAAGCAGGCTCTTC-5' end of cDNA, GAGCTCTCACCACTTTGTAC AAGAAAGCTGGGCGGCCGCTTTTTTTTTTTTTTTTTT-3' end of cDNA).
Symbol	RASL11B
cDNA sequence	DNA sequence (1956 bp) Predicted protein sequence (265 aa)
HaloTag ORF Clone	FHC10534
Flexi ORF Clone	FXC10534
Description	RAS-like, family 11, member B

Features of the cloned cDNA sequence

Description

Length: 1956 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.

Warning for N-terminal truncation: NO

Warning for coding interruption : NO

Integrity of 3' end

Length of 3'UTR	1029 bp
Genome contig ID	gi89161207f_53323252
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TTTATTTTATGTACAATAAATCGCATTTGAAAAAG
Flanking genome sequence (104508 - 104557)	----+--------+--------+--------+--------+----* AGCAGATGTCTAACTTCGTCTCTATTGAAACGTTAACTTTCTGCCGTTTA

Features of the protein sequence

Description

Length: 265 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9BPW5	1.9e-97	100.0	Ras-like protei...	Homo sapiens
BAB55008	1.2e-96	99.1	unnamed protein...	Homo sapiens
XP_001493884	2.2e-94	95.5	similar to RAS-...	Equus caballus
Q5E9J3	4.1e-94	95.9	Ras-like protei...	Bos taurus
XP_853940	1.2e-93	94.8	similar to RAS-...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001806	51	72	PR00449	Ras GTPase
	IPR001806	91	113	PR00449	Ras GTPase
	IPR001806	160	173	PR00449	Ras GTPase
	IPR001806	196	218	PR00449	Ras GTPase
HMMPfam	IPR013684	52	172	PF08477	Miro-like
HMMSmart	IPR003577	48	221	SM00173	Ras small GTPase
	IPR003579	51	221	SM00175	Ras small GTPase
	IPR003578	53	221	SM00174	Ras small GTPase
HMMTigr	IPR005225	48	215	TIGR00231	Small GTP-binding protein domain

Order Kazusa clone(s) from :

Japan || Other countries
Send a message to office AT kazusa.or.jp