Kazusa Clone (Original Type)
Gene/Protein Characteristic Table for ORK10534
Order Kazusa clone(s) from : Japan || Other countries
Accession No
Product ID ORK10534
Clone name bm05954
Vector information
The cDNA fragment was inserted at the XhoI-SacI site of the ...
Symbol RASL11B
cDNA sequence DNA sequence (1956 bp)
Predicted protein sequence (265 aa)
Flexi ORF Clone FXC10534
Description RAS-like, family 11, member B
Features of the cloned cDNA sequence

Length: 1956 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for : cloned DNA seq.
Warning for N-terminal truncation: NO
Warning for coding interruption : NO
Integrity of 3' end
Length of 3'UTR 1029 bp
Genome contig ID gi89161207f_53323252
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TTTATTTTATGTACAATAAATCGCATTTGAAAAAG
Flanking genome sequence
(104508 - 104557)
----+----*----+----*----+----*----+----*----+----*
AGCAGATGTCTAACTTCGTCTCTATTGAAACGTTAACTTTCTGCCGTTTA

Features of the protein sequence

Length: 265 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
Q9BPW5 1.9e-97 100.0 Ras-like protei...
Homo sapiens
BAB55008 1.2e-96 99.1 unnamed protein...
Homo sapiens
XP_001493884 2.2e-94 95.5 similar to RAS-...
Equus caballus
Q5E9J3 4.1e-94 95.9 Ras-like protei...
Bos taurus
XP_853940 1.2e-93 94.8 similar to RAS-...
Canis lupus fam...
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
FPrintScan IPR001806 51 72 PR00449 Ras GTPase
IPR001806 91 113 PR00449 Ras GTPase
IPR001806 160 173 PR00449 Ras GTPase
IPR001806 196 218 PR00449 Ras GTPase
HMMPfam IPR013684 52 172 PF08477 Miro-like
HMMSmart IPR003577 48 221 SM00173 Ras small GTPase
IPR003579 51 221 SM00175 Ras small GTPase
IPR003578 53 221 SM00174 Ras small GTPase
HMMTigr IPR005225 48 215 TIGR00231 Small GTP-binding protein domain
Order Kazusa clone(s) from : Japan || Other countries
Send a message to office AT kazusa.or.jp